SNP/Locus Name /TSC Designation:  TSC 0739545

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location
AC026066.4   AC026066   AL139218    AC099672.2

AC104458.2    NT_034383.4    AC012109.2

ss  2327556

Chr 1

rs 578487

76,045,653

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

A/T

minus strand

 

Reference Sequence  (FASTA format; at least 200 bp on either side of the SNP for primer/assay design)

5' flank:     tttggctgtt ctagctgcat ctcaagcagg cttaggtgtg gctcaacctg ctgctcaaga

                 agatacaagc tgtaaacctt ggcagtgttc ataggatact aattctgtag gcatagcttc

                 ttccatctgg attgcaaata atgttgcaga taacctgggg acctaggcag agacatgcta

                 caggggcaaa gcagacacaa ggagtcccca actagggcaa tgcccagagg ttctgtaggg

Observed:  W(a/t)

3' flank:     cagcaccact gccaaaacca cagaactgta gggccaccac catgcaactc taactgatga

                 gagctactga gtggactgag cccagtgaag ccttagggcg aggctgtctg aggttttggg

                 tgcccaatcc ccaactcccc aatgtgtcca ggatgtgaga catggaatcg aaagagatta

                 ttcttcagct ttaagattta acgtagtttt ccctgttgtg tttcagactt

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

FSS N. European (27)

A = 54%

T = 46%

1

FSS Indo-Pakistani (23)

A=  67%

T = 33%

1

FSS Afro-Caribbean (15)

A = 47%

T = 53%

1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) : ggttttggcagtggtgctg(a/t)

1

Reverse  Primers  :  aacctggggacctaggcaga

Detection probe   :   n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

                                                                  Primers designed to REVERSE strand

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus, equivalent

to other markers-Y SNPs, present in commercial assay)

 

Present in FSS  2nd Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1)  : 149 bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctatggttttggcagtggtgctga

                              Forward Universal Sequence 2: tgacgtggctgacctgagacggttttggcagtggtgctgt

                              Reverse Universal Sequence    : caagctggtggctgtgcaagaacctggggacctaggcaga

 References

1               FSS SNP PAPER

 

 

 RETURN TO HOMEPAGE