Primer sequences for PCR amplification of loci in NIST Y STR 20plex

 

 

Locus

 

 

Primer Sequences (5-to-3)

Primer

Concentration

(mM)

Primer3

Tm (oC)

DYS19

F

NED-ACTACTGAGTTTCTGTTATAGTGTTTTT

1.8

55.0

 

R

GTCAATCTCTGCACCTGGAAAT

1.8

60.5

DYS385

F

VIC-AGCATGGGTGACAGAGCTA

0.6

56.9

a/b

R

GCCAATTACATAGTCCTCCTTTC

0.6

54.7

DYS388

F

NED-GAATTCATGTGAGTTAGCCGTTTAGC

1.8

63.4

 

R

GAGGCGGAGCTTTTAGTGAG

1.8

59.2

DYS389

F

6FAM-CCAACTCTCATCTGTATTATCTATG

1.3

54.2

I/II

R

GTTATCCCTGAGTAGTAGAAGAATG

1.3

59.0

DYS390

F

VIC-TATATTTTACACATTTTTGGGCCC

0.2

57.2

 

R

GTGACAGTAAAATGAAAACATTGC

0.2

57.0

DYS391

F

6FAM-TTCAATCATACACCCATATCTGTC

0.2

57.9

 

R

GATAGAGGGATAGGTAGGCAGGC

0.2

60.0

DYS392

F

NED-TAGAGGCAGTCATCGCAGTG

1.8

60.2

 

R

GACCTACCAATCCCATTCCTT

1.8

57.3

DYS393

F

VIC-GTGGTCTTCTACTTGTGTCAATAC

0.4

54.7

 

R

GAACTCAAGTCCAAAAAATGAGG

0.4

57.7

DYS426

F

VIC-CTCAAAGTATGAAAGCATGACCA

0.2

59.3

 

R

GGTGACAAGACGAGACTTTGTG

0.2

59.8

DYS437

F

6FAM-GACTATGGGCGTGAGTGCAT

0.2

61.1

 

R

GAGACCCTGTCATTCACAGATGA

0.2

59.6

DYS438

F

6FAM-CCAAAATTAGTGGGGAATAGTTG

0.2

58.9

 

R

GATCACCCAGGGTCTGGAGTT

0.2

62.6

DYS439

F

6FAM-TCGAGTTGTTATGGTTTTAGGTCT

0.2

58.3

 

R

GTGGCTTGGAATTCTTTTACCC

0.2

60.3

DYS447

F

PET-GGTCACAGCATGGCTTGGTT

0.7

63.4

 

R

GGGCTTGCTTTGCGTTATCTCT

0.7

64.0

DYS448

F

PET-TGGGAGAGGCAAGGATCCAA

1.1

65.2

 

R

GTCATATTTCTGGCCGGTCTGG

1.1

64.3

460

F

NED-GAGGAATCTGACACCTCTGACA

0.7

59.3

(A7.1)

R

GTCCATATCATCTATCCTCTGCCTA

0.7

59.1

H4

F

NED-ATGCTGAGGAGAATTTCCAA

0.4

57.3

 

R

GCTATTCATCCATCTAATCTATCCATT

0.4

56.2

YCAII

F

VIC-TGTCAAAATTTAACCCACAATCA

0.9

59.3

a/b

R

GCAGTCTTTCACCATAAGGTTAGC

0.9

57.2

Source: Butler et al. (2002) Forensic Sci. Int., in press