SRM 2395-Human Y-Chromosome DNA Profiling Standard

 

NOW AVAILABLE: see http://www.nist.gov/srm

https://www-s.nist.gov/srmors/view_detail.cfm?srm=2395

 

The Certificate of Analysis for SRM 2395 has been updated with additional information for the 5 male components. These samples now have sequence information at over 40 different Y-STR markers and typed at an additional 3 Y-STRs and 42 Y-SNPs. This SRM may be used for calibrating methods for Y-STR typing with any primer set or commercially available kit.

 

 


[Supporting Sequence Information] [Yfiler Stutter Percentages] [Stability Information] [PCR and Sequencing Primers Used]

[Original SRM 2395 Certificate] https://srmors.nist.gov/view_cert.cfm?srm=2395


 

Y-chromosome loci present in the following kits are covered by SRM 2395:

PowerPlex Y, Yfiler, Marligen's Signet Y-SNP Identification System

 

Variable SNPs observed in 42 Y-SNP loci examined

SRM 2395 AMEL M207 M45 P25 M89 DYS391 M2 M170 M172 M201 SNP Haplogroup
  (A/G) (G/A) (C/A) (C/T) (C/G) (A/G) (A/C) (T/G) (G/T)  
Component A XY G A A T C A A T G R1b
Component B XY A G C T C A A G G J2
Component C XY A G C C G G A T G E3a
Component D XY A G C T C A A T T G
Component E XY A G C T C A C T G I
Component F XX                   --

 

Original Set of Sequenced Y-STR Loci

DYS19, DYS385 a/b, DYS388, DYS389I/II, DYS390, DYS391, DYS392, DYS393, DYS426, DYS435, DYS436, DYS437, DYS438, DYS439, DYS447, DYS448, DYS460, DYS461, DYS462, GATA-H4

 

Additional Y-STRs with Typing Results

DYS450, DYS456, DYS458, DYS464 a/b/c/d, YCAII a/b 

 

Added Since SRM 2395 Release

DYS635 (GATA-C4)

Component A - Male Genomic DNA 1 (23 repeats)
(TCTA)
4(TGTA)2(TCTA)2(TGTA)2(TCTA)2(TGTA)2(TCTA)9

Component B Male Genomic DNA 2 (21 repeats)
(TCTA)
4(TGTA)2(TCTA)2(TGTA)2(TCTA)11

Component C Male Genomic DNA 3 (23 repeats)
(TCTA)
4(TGTA)2(TCTA)2(TGTA)2(TCTA)13

Component D Male Genomic DNA 4 (21 repeats)
(TCTA)
4(TGTA)2(TCTA)2(TGTA)2(TCTA)11

Component E Male Genomic DNA 5 (21 repeats)
(TCTA)
4(TGTA)2(TCTA)2(TGTA)2(TCTA)11
 

Stutter Percentages

Note: We have received reports from multiple forensic DNA laboratories that elevated stutter (>20%) has been observed with the longer DYS385 allele in components B (allele 17) and C (alleles 17 and 20).

 

Stutter percentages for the 5 male SRM 2395 components with the 17 Yfiler loci

 

Sample Name

A

B

C

D

E

DYS456

9.0

9.4

10.0

9.2

9.2

DYS389I

5.0

5.1

6.0

4.3

6.8

DYS390

9.5

7.9

3.4

5.9

8.2

DYS389II

10.7

9.2

10.9

9.2

11.9

DYS458

7.2

6.5

8.5

7.2

7.7

DYS19

5.7

6.4

7.7

6.9

9.1

DYS385a

8.4

8.2

9.8

8.3

7.4

DYS385b

9.2

14.7

14.8

N/A*

10.1

DYS393

9.5

7.4

8.0

8.5

8.8

DYS391

6.6

6.8

7.8

5.8

4.3

DYS439

7.5

5.7

5.5

5.8

5.0

DYS635

4.6

6.6

8.5

7.1

6.8

DYS392

12.1

7.5

8.6

7.1

8.8

DYS392 (N+3)

6.4

3.4

3.2

3.1

3.2

Y-GATA-H4

7.0

6.6

6.5

6.5

6.1

DYS437

4.5

3.6

3.6

5.5

5.5

DYS438

2.5

1.9

2.1

2.2

2.5

DYS448

2.2

2.6

2.4

2.3

2.5

*N/A stutter could not be determined due to allele in stutter position

 

 

 

 Supporting Sequence Information

 

Certified allele repeat numbers using GS500-LIZ size standard for base pair sizing

 

 

DYS456

Repeat Motif

bp size

 

 

DYS607

Repeat Motif

bp size

A

15

[AGAT]15

111.15

 

A

19

[GAAG]15[GAAA][GAAG][GAAA][GAAG]

198.16

B

15

[AGAT]15

111.13

 

B

19

[GAAG]15[GAAA][GAAG][GAAA][GAAG]

197.86

C

15

[AGAT]15

111.14

 

C

19

[GAAG]15[GAAA][GAAG][GAAA][GAAG]

197.94

D

15

[AGAT]15

111.13

 

D

17

[GAAG]13[GAAA][GAAG][GAAA][GAAG]

190.12

E

15

[AGAT]15

110.97

 

E

18

[GAAG]14[GAAA][GAAG][GAAA][GAAG]

194.02

 

 

 

 

 

 

 

 

 

 

DYS458

Repeat Motif

bp size

 

 

DYS635

Repeat Motif

bp size

A

16

[GAAA]16

140.39

 

A

23

[TCTA]4[TGTA]2[TCTA]2[TGTA]2[TCTA]2[TGTA]2[TCTA]9

260.32

B

15

[GAAA]14 GGAA

136.52

 

B

21

[TCTA]4[TGTA]2[TCTA]2[TGTA]2[TCTA]11

252.66

C

17

[GAAA]17

144.69

 

C

23

[TCTA]4[TGTA]2[TCTA]2[TGTA]2[TCTA]13

260.39

D

16

[GAAA]16

140.36

 

D

21

[TCTA]4[TGTA]2[TCTA]2[TGTA]2[TCTA]11

252.17

E

16

[GAAA]16

140.31

 

E

21

[TCTA]4[TGTA]2[TCTA]2[TGTA]2[TCTA]11

252.05

 

 

 

 

 

 

 

 

 

 

DYS492

Repeat Motif

bp size

 

 

DYS652

Repeat Motif

bp size

A

12

[ATT]12

217.81

 

A

24

[TAATA]6 TAAAA [TAATA]10 TAAAA [TAATA]6

210.76

B

12

[ATT]12

217.86

 

B

25

[TAATA]9 TAAAA [TAATA]8 TAAAA [TAATA]6

215.87

C

11

[ATT]11

214.64

 

C

25

[TAATA]7 TAAAA [TAATA]8 TAAAA [TAATA]8

215.81

D

11

[ATT]11

214.57

 

D

23

[TAATA]6 TAAAA [TAATA]9 TAAAA [TAATA]6

205.64

E

12

[ATT]12

217.67

 

E

26

[TAATA]7 TAAAA [TAATA]11 TAAAA [TAATA]6

220.61

 

 

 

 

 

 

 

 

 

 

DYS532

Repeat Motif

bp size

 

 

DYS709

Repeat Motif

bp size

A

15

[CTTT]15

490.63

 

A

13

[CTTT]13

197.83

B

11

[CTTT]11

474.47

 

B

16

[CTTT]16

209.96

C

12

[CTTT]12

478.52

 

C

15

[CTTT]15

205.89

D

15

[CTTT]15

490.38

 

D

17

[CTTT]17

213.75

E

9

[CTTT]9

466.35

 

E

16

[CTTT]16

209.76

 

 

 

 

 

 

 

 

 

 

DYS534

Repeat Motif

bp size

 

 

DYS710

Repeat Motif

bp size

A

15

[CTTT]15

214.65

 

A

36

[AAAG]18 [AG]16 [AAAG]10

233.72

B

15

[CTTT]15

214.91

 

B

34.2

[AAAG]16 [AG]13 [AAAG]12

227.65

C

15

[CTTT]15

214.87

 

C

35.2

[AAAG]20 [AG]9 [AAAG]4 AAGG [AAAG]6

231.51

D

14

[CTTT]14

210.79

 

D

33.2

[AAAG]16 [AG]9 [AAAG]13

223.41

E

14

[CTTT]14

210.81

 

E

31

[AAAG]14 [AG]12 [AAAG]11

214.00

 

 

 

 

 

 

 

 

 

 

DYS570

Repeat Motif

bp size

 

 

DYS715

Repeat Motif

bp size

A

17

[TTTC]17

264.01

 

A

24

[TAGA]14 N20 [TGGA]10

195.4

B

18

[TTTC]18

268.32

 

B

21

[TAGA]11 N20 [TGGA]10

183.51

C

18

[TTTC]18

268.21

 

C

22

[TAGA]12 N20 [TGGA]10

187.36

D

17

[TTTC]17

263.66

 

D

23

[TAGA]13 N20 [TGGA]10

191.29

E

18

[TTTC]18

267.88

 

E

23

[TAGA]12 N20 [TGGA]11

191.37

 

 

 

 

 

 

 

 

 

 

DYS572

Repeat Motif

bp size

 

 

DYS717

Repeat Motif

bp size

A

11

[AAAT]11

254.21

 

A

17

TGTAT [TGTAC]6 [TGTAT]10

253.94

B

11

[AAAT]11

254.04

 

B

17

TGTAT [TGTAC]6 [TGTAT]10

253.99

C

9

[AAAT]9

245.94

 

C

17

TGTAT [TGTAC]6 [TGTAT]10

253.73

D

9

[AAAT]9

245.87

 

D

20

TGTAT [TGTAC]8 [TGTAT]11

269.00

E

11

[AAAT]11

253.95

 

E

14

TGTAT [TGTAC]6 [TGTAT]7

238.39

 

 

 

 

 

 

DYS576

Repeat Motif

bp size

 

A

18

[AAAG]18

197.28

 

B

16

[AAAG]16

189.52

 

C

17

[AAAG]17

193.44

 

D

18

[AAAG]18

197.23

 

E

17

[AAAG]17

193.40

 

 

 

 

Certified and Reference Values Method Dependent (GeneScan 600-LIZ size standard used for base pair sizing)

 

 

DYS449

Repeat Motif

bp size

 

 

DYS527

Repeat Motif

bp size

A

28

[TTTC]14N50[TTTC]14

349.93

 

A

21

[GAAA]14 [GGAA]7

353.90

B

32

[TTTC]16N50[TTTC]16

365.58

 

 

23

[GAAA]16 [GGAA]7

361.74

C

30

[TTTC]16N50[TTTC]14

357.78

 

B

22

[GAAA]16 [GGAA]6

357.71

D

28

[TTTC]15N50[TTTC]13

349.94

 

C

17*

 

338.15

E

27

[TTTC]13N50[TTTC]14

346.04

 

 

20

[GAAA]13 [GGAA]7

350.01

 

 

 

 

 

D

15

[GAAA]9 [GGAA]6

330.41

 

DYS481

Repeat Motif

bp size

 

 

21

[GAAA]15 [GGAA]6

353.81

A

22

[CTT]22

132.16

 

E

22

[GAAA]15 [GGAA]7

357.78

B

23

[CTT]23

135.11

 

 

23*

 

361.73

C

28

[CTT]28

150.47

 

 

 

 

 

D

23

[CTT]23

135.15

 

 

DYS650

Repeat Motif

bp size

E

28

[CTT]28

150.45

 

A

18

[AAGG]17 AAAG

283.41

 

 

 

 

 

B

18

[AAGG]15 AAGA [AAAG]2

283.25

 

DYS522

Repeat Motif

bp size

 

C

16

[AAGG]13 AAGA [AAAG]2

275.59

A

10

[GATA]10

357.03

 

D

18

[AAGG]15 AAGA [AAAG]2

283.27

B

11

[GATA]11

361.02

 

E

24*

 

306.62

C

10

[GATA]10

356.96

 

 

 

 

 

D

12

[GATA]12

365.00

 

 

DYS712

Repeat Motif

bp size

E

12

[GATA]12

365.16

 

A

23

[AGAT]18 [AGAC]5

177.49

 

 

 

 

 

B

22.3

[AGAT]2 GAT[AGAT]14[AGAC]6

176.42

 

 

 

 

 

C

21

[AGAT]15 [AGAC]6

169.34

 

 

 

 

 

D

26

[AGAT]17 [AGAC]9

189.48

 

 

 

 

 

E

19

[AGAT]12 [AGAC]7

161.15

 

*Alleles in italic and bold are reference values because no sequence data has been generated, therefore no repeat motif is listed

 

 

Primers Used

 

PCR primer sequences for the 21 Y-STR loci of interest.

Yfiler kit primers are proprietary to Applied Biosystems

 

PCR primers

Locus ID

Primer Sequence

DYS449-F

CCTGGAAGTGGAGTTTGCTGT

DYS449-R

gtttcttTGGAGTCTCTCAAGCCTGTTCTA

DYS456-F

Yfiler kit (Applied Biosystems)

DYS456-R

Yfiler kit (Applied Biosystems)

DYS458-F

Yfiler kit (Applied Biosystems)

DYS458-R

Yfiler kit (Applied Biosystems)

DYS481-F

AGGAATGTGGCTAACGCTGT

DYS481-R

gtttcttACAGCTCACCAGAAGGTTGC

DYS492-F

AGATGAGCCAGGCTTCAGAC

DYS492-R

gtttcttAGTAGGGGTCAGGCACAATG

DYS522-F

CCTTTGAAATCATTCATAATGC

DYS522-R

gtttcttTCATAAACAGAGGGTTCTGG

DYS527-F

TCGCAAACATAGCACTTCAG

DYS527-R

gtttcttTTCTAGGAAGATTAGCCACAACA

DYS532-F

TTGGTTTTATGCCTTTCACT

DYS532-R

gtttcttTAGGTGACAGAGCAGGATTC

DYS534-F

CATCTACCCAACATCCATCTA

DYS534-R

gtttcttGACAAAGATGTTAGATGAATAGACA

DYS570-F

GAACTGTCTACAATGGCTCACG

DYS570-R

gtttcttTCAGCATAGTCAAGAAACCAGACA

DYS572-F

CTAAGGACGCCTCCCATACA

DYS572-R

gtttcttCTCATTCCCTATGGTTTGCAC

DYS576-F

TTGGGCTGAGGAGTTCAATC

DYS576-R

gtttcttGGCAGTCTCATTTCCTGGAG

DYS607-F

AGCATACAGCGTAATCACAGC

DYS607-R

gtttcttTCAGACAAAGCCCAGTTGAG

DYS635-F

Yfiler kit (Applied Biosystems)

DYS635-R

Yfiler kit (Applied Biosystems)

DYS650-F

TCACATGCCTACAGTCACAGC

DYS650-R

gtttcttCTCTTTCTCCCTTCCCACCT

DYS652-F

CACAGCATGGCTTGGTTTTA

DYS652-R

gtttcttTTTGCGTTATCTCTGCCTTTC

DYS709-F

GTTGCCATGGTTTCTTGCTT

DYS709-R

gtttcttCGAACCTGCAAATTGTTCAC

DYS710-F

GAGGTCAAGGCTGCAAGAATCTATGA

DYS710-R

gtttcttCATACTCTCTCCCTCCCTCTCTTTTTTC

DYS712-F

CAAGAACAGCCTGGGTAACAGTG

DYS712-R

gtttcttTTATATGGTACAGCCCATGAACACTT

DYS715-F

ATGGTTGGAAGAAAGCATTGATGA

DYS715-R

gtttcttCTAGGTAATTAGCTACCTAGTTAG

DYS717-F

GGCCGAGAGAATGGAATTGAT

DYS717-R

gtttcttCCCGAACTTCAGCACTATGAAATG

 

 

Sequencing primer sequences for the 21 new Y-STR loci

 

Sequencing primers

 

 

Locus ID

Primer Sequence

Length

Amp size (bp)

DYS449-F

tgctgtatgttctaatcttaggttgc

26

478

DYS449-R

ctgaggccggataattgct

19

 

DYS456-F

actcggactggctcatcttg

20

197

DYS456-R

cccatcaactcagcccaaaac

21

 

DYS458-F

gggtggtggaggttactgtg

20

320

DYS458-R

ctagaggttcctgccaccac

20

 

DYS481-F

ttctgtgagagtgttgcgaga

21

243

DYS481-R

acccaagaagagccacacag

20

 

DYS492-F

tgtgcagtggacaggaagaa

20

394

DYS492-R

tgaacctgggcaacatagtg

20

 

DYS522-F

ccacaatgctttccttacacc

21

472

DYS522-R

agggtggggaactttctgat

20

 

DYS527-F

gctggaattcagaaggtgga

20

543

DYS527-R

cattttctcaaaatccagtgaga

23

 

DYS532-F

tgtagataatgggcaaaatgg

21

589

DYS532-R

attgcttgaacttgggatgg

20

 

DYS534-F

tcattgtctaccattcactttctttc

26

468

DYS534-R

tcatgatcagttcttaactcaacca

25

 

DYS570-F

tcatccaattgctgtctttttg

22

372

DYS570-R

gaagggcttctaagggatgc

20

 

DYS572-F

tgggtattgcattcaccaac

20

385

DYS572-R

ttgctttctcagatgctggtt

21

 

DYS576-F

tgagagactgaggtaggaagatcc

24

248

DYS576-R

tgggtgggaacatagtcaaa

20

 

DYS607-F

gtctcactctgtcccccaag

20

244

DYS607-R

ttcaggtccagtcatgagaaaa

22

 

DYS635-F

gcatgaataacgaactcactatagg

25

363

DYS635-R

gaccaaggctccatctcaaa

20

 

DYS650-F

tcacatgcctacagtcacagc

21

280

DYS650-R

ctctttctcccttcccacct

20

 

DYS652-F

aggacatgcctgtgctacaa

20

300

DYS652-R

gggaggggaagtacatggaa

20

 

DYS709-F

tttttgcctgccatattggt

20

293

DYS709-R

tgacgagttaatgggtgcag

20

 

DYS710-F

gcagtcccagctactccaaa

20

297

DYS710-R

catactccctccctcccttc

20

 

DYS712-F

gattgcttgagcccagaagt

20

248

DYS712-R

gccaccagggattatgatatg

21

 

DYS715-F

tgatagatggataaatggatgaatg

25

333

DYS715-R

tctatctcatctttgtctctttctgc

26

 

DYS717-F

gccatggatggtggtagaac

20

339

DYS717-R

ttgttcaggtgaggaatatgct

22

 

 

 

Stability Testing

 

Results from the multiple analyses of the original two units of SRM 2395 obtained from MSD are averaged together.

 

DNA concentrations of SRM 2395 components A F as determined by multiple qPCR analysis runs.

IH unit stored in-house since production

MSD units stored at MSD: 2 units obtained from MSD, n=4 is the average of replicates from each unit.  The trends for the results from the two MSD units are displayed in figure below.

 

 

-20 C  IH

-20 C MSD

-20 C MSD

-20 C MSD

-20 C MSD

 

n=2

10/30/07

n=4

10/25/07 AM

n=4

10/25/07 PM

n=4

10/30/07

n=0,1, or2

11/29/07

Component

Avg

sd

Avg

sd

Avg

sd

Avg

sd

Avg

sd

A

2.06

0.35

0.89

0.13

0.87

0.16

1.05

0.11

1.41

0.09

B

1.59

0.42

0.85

0.10

1.00

0.13

0.91

0.20

1.42

0.01

C

1.66

0.42

1.07

0.18

1.12

0.14

1.19

0.14

1.49

0.06

D

1.43

0.40

0.99

0.21

1.01

0.23

0.99

0.17

1.41

0.15

E

1.55

0.47

1.02

0.11

1.13

0.16

1.09

0.15

1.33

0.06

F

1.36

0.14

0.97

0.04

0.96

0.11

1.03

0.13

1.01

0.07

 

 

 

 

 

 

 

 

 

 

 

 

 

Trends of the analyses of the two MSD units of SRM 2395. Each line represents a component of SRM 2395, points along the lines correspond to analyses DNA concentrations.  Components A-E are approaching the original nominal DNA concentration of 2 ng/L.  The DNA concentration of component F appears constant at 1 ng/L.

 

 

 

 


Return to Y-Chromosome Section of STRBase

Last Updated: 12/15/2009