GenBank Entries |
NCBI Submitted SNP ID
NCBI Reference SNP ID
|
Genomic location |
|
AC019089.3 NT_006216
NT_006216.14 |
ss 2270014 |
Chr 4 |
|
rs 1453461 |
72,703,499 |
|
Polymorphism (ancestral/derived,
if known) |
Orientation with respect
to GenBank accession (+/-) |
|
A/T |
plus strand |
Reference Sequence (FASTA format; at least
200 bp on either side of the SNP for primer/assay design)
|
5' flank: gagcattggc tgggtttaca tctgcatttt
ggctcagctt ttcctgactg tgtgatcttg ggaaagtatt taactttata aaaattaatt gttgcatgtc
aaatgacaat atttgcattt tagagtgttc ctattttttt gcgtctgccc tacaagccat
gacagcaatt tttcctggaa tcttccttcc tctaacctgt catccacatg gctaccctgg aaattgccaa ggtggtaaaa aaaaaaaaaa aaaaaaaaga gtgagttttc cactctccag
tctacccatt tacctgtact ggggctttcc ctttcctacc actgctgtct gtgg Observed:
W(a/t) 3' flank:
gggtcaaatg tcctatgctc tatttggggg cacttatgag tgtcctgcct aatgataatg acagttccca tggaggttct gcaaagtctt gaggcataga
cagatactaa tatgctggac agttcactat catcagtgga ggccactgat
ggtggcagct gttatccgcc caacgatgac gacagccact gaatggttta ttctgccaaa |
|
Panel (No. of Individuals) |
Allele 1 Frequency |
Allele 2 Frequency |
References |
|
|
|
|
|
|
FSS N. European (27) |
T = 24% |
A = 76% |
1 |
|
FSS Indo-Pakistani (23) |
T = 26% |
A = 74% |
1 |
|
FSS Afro-Caribbean (15) |
T = 47% |
A = 53% |
1 |
|
|
|
|
|
|
|
|
|
|
|
Detection
Protocol |
PCR Primer/Probe
Sequences |
Reference |
|
FSS
URP Autosomal SNP Detection Protocol |
Forward Primer(s) : tttcctaccactgctgtctgtgg(a/t) |
1 |
|
Reverse Primers
: ctcataagtgcccccaaatagagca |
||
|
Detection probe
: n/a |
||
|
|
Forward Primer(s) : |
|
|
Reverse Primers
: |
||
|
Detection probe
: |
||
|
|
Forward Primer(s) : |
|
|
Reverse Primers
: |
||
|
Detection probe
: |
||
|
|
Forward Primer(s) : |
|
|
Reverse Primers
: |
||
|
Detection probe
: |
||
|
|
Forward Primer(s) : |
|
|
Reverse Primers
: |
||
|
Detection probe
: |
General Comments (e.g., utility/usage in multiplexes, multi-copy locus,
equivalent to other markers-Y SNPs, present in commercial assay)
Present in FSS 2nd Autosomal SNP Multiplex Assay (1)
Amplicon size in PCR (1) : 104 bp
PCR Cycling Conditions : 95c 11mins ; 94c 30s,
60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s x6 Cycles
94c 30s, 76c 105s x29 Cycles
94c 60s, 60c 30s, 72c 60s x3 Cycles
60c 10mins
URP Sequences : Forward Universal Sequence 1: cgacgtggtggatgtgctattttcctaccactgctgtctgtgga
Forward Universal Sequence 2:
tgacgtggctgacctgagactttcctaccactgctgtctgtggt
Reverse Universal Sequence : caagctggtggctgtgcaagctcataagtgcccccaaatagagca
References
1
FSS SNP PAPER