SNP/Locus Name /TSC Designation :   TSC 0478751

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location
  AC017021.3    AC020606    AC017021    AC020606.6

NT_007933.12

ss  2127705

Chr 7

rs 675236

112,865,314

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

A/T

minus strand

 

 

Reference Sequence  (FASTA format; at least 200 bp on either side of the SNP for primer/assay design)

5' flank:     gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt gtggcttatg tgacgtcaat

                 ggaaaataga ggaagatgca agggcatcat ccatccccaa gcatctttgg actaatttta

                 attatccttg aaaaaaggtt ttggattcag aagcagatgg gactcctgaa agggcctttc

                 tgagagtatg ggaa

Observed:  W(a/t)

3' flank:     aagaattgct gcttctgggg cccggatgac cacatgtggc tcagagttgg aaggacacca

                 ttttccttgg ctctgcacag aacccagcac ctcaccagag ttgcagtgac tggaaaccca

                 tgcagcatca gtgagcgcgc atccctggcg agaacattcc attctctcgg tgctaatgag

                 gatgctctaa tagtctggtt ttggcagcat ttgtagaa

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

FSS N. European (27)

A =  65%

T =  35%

1

FSS Indo-Pakistani (23)

A=   61%

T =  39%

1

FSS Afro-Caribbean (15)

A =  74%

T =  26%

1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) : ccccagaagcagcaattctt(a/t)

1

Reverse  Primers  :  tggattcagaagcagatggga

Detection probe   :   n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

                                                                  Primers designed to REVERSE strand

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus, equivalent to

other markers-Y SNPs, present in commercial assay)

 

Present in FSS  2nd Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1)  : 114bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctatccccagaagcagcaattctta

                              Forward Universal Sequence 2: tgacgtggctgacctgagacccccagaagcagcaattcttt

                              Reverse Universal Sequence    : caagctggtggctgtgcaag tggattcagaagcagatggga

 References

1               FSS SNP PAPER

 

 

 

 

 RETURN TO HOMEPAGE