GenBank Entries |
NCBI Submitted SNP ID
NCBI Reference SNP ID
|
Genomic location |
|
AC005659.3 AC005658
AC006173.1 AL356419.4 NT_030059 NT_030059.10 |
ss 1315218 |
Chr 10 |
|
rs
181619 |
118,606,454 |
|
Polymorphism (ancestral/derived,
if known) |
Orientation with respect
to GenBank accession (+/-) |
|
A/C |
Minus strand |
Reference Sequence (FASTA format; at least
200 bp on either side of the SNP for primer/assay design)
|
5' flank: cagggctggg tcaagctgtc ccattgggtg ggtctttccg
atgcaaagtt actggtcttc
cagaagttct cctgcatctt ttccttccct ccccactgct ccaccatgct gtagttcagc
tcttcatccc tcacacccgg acaactcaac ctcttccaag tggcctctgc ccccagtcta
tcccccactg ttgtagcaga tcactttgct gcttttatgc agaaaacttc agtggctctg
ccgctcccag gaaacagtgg agacccctca gccctgcact caggacctgc tcagtgcaac
cctcgcttcc ttgccaaccc caatctccaa cactttctaa cgctgcttcc actcccaggc
cctgttccct cctggagggc aacagagggt ctgtcttctt gcctggagca tgagctgacc a Observed: M(a/c) 3' flank: agggggtcct gaagagagag ccacttggca ggggcaccgg
cagatgctgg aagggacttc
cacacatagc cacccctcac acccactccc cattgttctt cagagcctca cccagaagaa
cacagatttg caggcccact ttggtacgtg tcggagaaca tggagagcca gtcctaaggc
ataaagggaa accaagtcac agttgg |
|
Panel (No. of Individuals) |
Allele 1 Frequency |
Allele 2 Frequency |
References |
|
|
|
|
|
|
FSS N. European (86) |
C = 70% |
A = 30% |
1 |
|
FSS Indo-Pakistani (33) |
C = 82% |
A = 18% |
1 |
|
FSS Afro-Caribbean (29) |
C = 78% |
A = 22% |
1 |
|
|
|
|
|
|
|
|
|
|
|
Detection
Protocol |
PCR
Primer/Probe Sequences |
Reference |
|
FSS
URP Autosomal SNP Detection Protocol |
Forward Primer(s) : cctggagcatgXgctgacca(a/c) |
1 |
|
Reverse Primers
: ggctctgaagaacaatggggag |
||
|
Detection probe
: n/a |
||
|
|
Forward Primer(s) : |
|
|
Reverse Primers
: |
||
|
Detection probe
: |
||
|
|
Forward Primer(s) : |
|
|
Reverse Primers
: |
||
|
Detection probe
: |
||
|
|
Forward Primer(s) : |
|
|
Reverse Primers :
|
||
|
Detection probe
: |
||
|
|
Forward Primer(s) : |
|
|
Reverse Primers
: |
||
|
Detection probe
: |
X = Inosine
General Comments (e.g., utility/usage in multiplexes, multi-copy locus,
equivalent to other markers-Y SNPs, present in commercial assay)
Present in FSS Autosomal Snp Multiplex Assay (1)
Amplicon size in PCR (1) : 168bp
PCR Cycling Conditions : 95c 11mins ; 94c 30s,
60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s x6 Cycles
94c 30s, 76c 105s x29 Cycles
94c 60s, 60c 30s, 72c 60s x3 Cycles
60c 10mins
URP Sequences : Forward Universal Sequence 1: cgacgtggtggatgtgctat cctggagcatgXgctgaccac
Forward Universal Sequence 2:
tgacgtggctgacctgagac cctggagcatgXgctgaccaa
Reverse Universal Sequence : caagctggtggctgtgcaag ggctctgaagaacaatggggag
References
1
FSS SNP PAPER