SNP/Locus Name /TSC Designation :   TSC 0154197

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

AC004228.2  AF139813.1  AC003025  AP000591.2AP000591.3  NT_033903

 

ss  1314263

Chr 11

rs 174473

63,247,780

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

C/T

Plus strand

 

 

Reference Sequence  (FASTA format; at least 200 bp on either side of the SNP for primer/assay design)

5' flank: tggccccgcc cctgccatgc ctcacctcct gcat

Observed:  Y(c/t)

3' flank: gtgaagtcca ggcaggggcc cacgtcctcc cggtacaccc tttccaggaa ggggcaggtc

          ttgtccaggg tgggggattc cctccaggcc tggaactctg caaacaggat tgtgtccacc

          tgtgggggag ggcaagcgag ggtgggggcg gtcagggtac tggggccagc atagaagatg

          caggctgagc tgaaggggag cgagggagga cgtggggcag gcccagcaag ccagcaggtc

          gatccccagc agccgtgcag ggaagccaag tccagcagca gcagagctcc cttctgccct

          ttgcaccaaa gaatttagaa ctaaaagttt tgtttccagg ccggtgttaa atttcttggc

          gctactggat tttagagtgg ggtgcagggc tttgtcctga agaccctcag tgcct

         

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

 

 

 

 

FSS N. European (86)

T = 77%

C = 23%

1

FSS Indo-Pakistani (33)

T = 53%

C = 47%

1

FSS Afro-Caribbean (29)

T = 67%

C = 33%

1

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) : ccatgcctcacctcctgcat(c/t)

1

Reverse  Primers  : caatcctgtttgcagagttccag

Detection probe   :   n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus,

equivalent to other markers-Y SNPs, present in commercial assay)

 

Present in FSS  Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1)  : 173bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctatccatgcctcacctcctgcatt

                              Forward Universal Sequence 2: tgacgtggctgacctgagacccatgcctcacctcctgcatc

                              Reverse Universal Sequence    : caagctggtggctgtgcaagcaatcctgtttgcagagttccag

 

 References

1               FSS SNP PAPER

 

 

 

 

 RETURN TO HOMEPAGE